|
PHP for Bioinformatics |
Installation
The following are required to develop bioinformatics applications using GenePHP:
Any would do (notepad for Windows, vi for Unix) but if you want an integrated development environment completed with debugging tools, check out PHPEd from Nusphere Corporation. If you intend to develop complex web-based bioinformatics applications, an HTML editor like Microsoft Frontpage or Macromedia Dreamweaver would be useful.
Teaching you how to install the above software or how to program in the PHP
scripting language is beyond the scope of this tutorial. The links listed above
have more than enough information on that subject.
To use GenePHP, take the following steps:
If you downloaded the TAR package: Unix prompt> tar -xv genephp_1.0.tar If you downloaded the ZIP package: DOS prompt> pkunzip genephp_1.0.zip
<?php
require_once("seq.php");
require_once("seqdb.php");
require_once("resten.php");
require_once("seqdb.php");
require_once("etc.php");
// The rest of your PHP code here.
?>
Which file(s) to include depends on the GenePHP classes and methods you intend to use in your PHP script. If in doubt, include all of them. For more information, consult the GenePHP Technical Documentation. Later, I might release a package where all the code is in just one file for convenience.
[ Back to Top ] [ Back to Homepage
]
Quickstart
I. Working with Sequence Databases
A. Create, open, and navigate a database
Before you can even begin writing serious bioinformatics applications, you must have access to a sequence database. There are two ways of accessing sequence data - online (through the internet) or offline (the file(s) is stored locally in your computer). GenePHP version 1.0 only supports the latter method. Also, it only supports the GenBank format from the National Center for Biotechnology Information (NCBI) and the Swissprot format from the EMBL.
You can download sequence data from these sites.
B. Read a sequence from a database
Once you've downloaded one or more *.SEQ files, place them in your webserver's document root directory together with your GenePHP files.
Let's assume our *.SEQ file is named gbuna.seq.
Before GenePHP can do anything with our *.SEQ file, we must first create indexes for them.
The script snippet below illustrates this.// Syntax: $seqdb = new seqdb($dbname, $dbformat, $file1, $file2, ...);
<?php
require_once("seqdb.php");
$seqdb_obj = new seqdb("myfirstdb", "", "gbuna.seq");
?>The second argument (database format) is optional. Passing a blank string sets it to its default value of "GENBANK".
The third, fourth, and succeeding arguments (virtually unlimited) are the *.SEQ files we wish to include in our database. To keep things simple, we've only provided one *.SEQ file in our example.Save and run the script in your debugger or web browser. While you may not see any visual feedback, you can check if your script worked by looking for two files in your document root, myfirstdb.idx and myfirstdb.dir. If they're there, then your script worked just fine. If not, then Houston, we have a problem! We will learn more about trapping these kinds of errors (failure of open/create databases) later.
II. Sequence Analysis
There are quite a number of tools included in GenePHP 1.0 for analyzing sequences. Here is just one example.
To find all mirrors inside a sequence string, we use the find_mirrors() function. Recall that this function would return a three-dimensional array of the form:
([len1] => ((mirror1, pos1), (mirror2, pos2)), [len2] => ( ), )
The code below would list all mirrors within the sequence "AGGGAATTAAGTAAATGGT
AGTGG", that have even lengths between 6 and 8 letters.CODE: <?php require("seq.php"); $seq_obj = new seq(); $seq_obj->sequence = "AGGGAATTAAGTAAATGGTAGTGG"; $mirrors_found = find_mirror($seq_obj->sequence, 6, 8, "E"); print "List of Mirrors Found<BR>"; foreach($mirrors_found as $mirror_length => $mirrors_samelength) { print "Of Length $mirror_length<BR>"; foreach($mirrors_samelength as $mirror) { print " "; print "Mirror String: " . $mirror[0] . " Position Index: " . $mirror[1]; print "<BR>"; } } ?> OUTPUT: List of Mirrors Found Of Length 6 Mirror String: AATTAA Position Index: 4 Mirror String: ATGGTA Position Index: 14 Of Length 8 Mirror String: GAATTAAG Position Index: 3